Written by

Discussion Yone Moreno · Sep 19, 2022

[Coding Challenge] Complementary DNA

Hello community,

Yesterday was celebrated the "World Medical Ethics Day" https://www.ama.com.au/media/wma-medical-ethics-day

We could celebrate it with a programming quiz or challenge:

DESCRIPTION:

Deoxyribonucleic acid (DNA) is a chemical found in the nucleus of cells and carries the "instructions" for the development and functioning of living organisms.

If you want to know more: http://en.wikipedia.org/wiki/DNA

In DNA strings, symbols "A" and "T" are complements of each other, as "C" and "G". Your function receives one side of the DNA (string, except for Haskell); you need to return the other complementary side. DNA strand is never empty or there is no DNA at all (again, except for Haskell).

More similar exercise are found here: http://rosalind.info/problems/list-view/ (source)

Example: (input --> output)

"ATTGC" --> "TAACG"
"GTAT" --> "CATA"
 

Satement extracted from: https://www.codewars.com/kata/554e4a2f232cdd87d9000038/java

Test cases:

import org.junit.Test;
import static org.junit.Assert.assertEquals;
import org.junit.runners.JUnit4;


public class DnaStrandTest {
    @Test
    public void test01() {
       assertEquals("TTTT", DnaStrand.makeComplement("AAAA"));
    }
    @Test
    public void test02() {
       assertEquals("TAACG", DnaStrand.makeComplement("ATTGC"));
    }
    @Test
    public void test03() {
       assertEquals("CATA", DnaStrand.makeComplement("GTAT"));
    } 
    @Test
    public void test04() {
       assertEquals("TTCC", DnaStrand.makeComplement("AAGG"));
    } 
    @Test
    public void test05() {
       assertEquals("GCGC", DnaStrand.makeComplement("CGCG"));
    } 
    @Test
    public void test06() {
       assertEquals("TAACG", DnaStrand.makeComplement("ATTGC"));
    } 
    @Test
    public void test07() {
       assertEquals("CATAGCTAGCTAGCTAGCTAATATAAAAGCTGCTCTAAATTTATATATATATATGCTCTCTTATGTCTATCTGTCTAAT", DnaStrand.makeComplement("GTATCGATCGATCGATCGATTATATTTTCGACGAGATTTAAATATATATATATACGAGAGAATACAGATAGACAGATTA"));
    }     
}

 

🌐🕸📔 Would you be able to code a solution for this?

Comments

Yone Moreno · Sep 19, 2022

As a reference a the Java solution:

Could be:

import java.util.*;

public class DnaStrand {

  static final Map<String,String> letters = Map.ofEntries(Map.entry("A","T"),Map.entry("T","A"),Map.entry("G","C"),Map.entry("C","G"));

  public static String makeComplement /*🧬🔁🧬*/ (String dna) {
    StringBuilder result = new StringBuilder();
    
    for(String letter:dna.split("")){
      result.append(letters.get(letter));
    }
    return result.toString();
  }
}

Would you like to improve this in ObjectScript?

Are you able?

0
Julius Kavay  Sep 19, 2022 to Yone Moreno

Hmm, ... will be difficult, but I give it a try

ClassMethod DNA(dna) As%String
{
	q$tr(dna,"CGAT","GCTA")
}
0
Timothy Leavitt · Sep 19, 2022

Hard for any language to beat:

ClassMethod makeComplement(d As %String) As %String
{
 q $tr(d,"ATGC","TACG")
}
0
Dmitry Maslennikov  Sep 19, 2022 to Timothy Leavitt
ClassMethod makeComplement(dna As %String) As %String [language = python]
{
  return dna.translate(dna.maketrans("CGAT","GCTA"))
}
0
Alex Woodhead  Sep 21, 2022 to Timothy Leavitt

Great spot @Timothy Leavitt 
Extra syntax sugar, can project as method expression to make more transparently embedded.

ClassMethod makeComplement(As %String) As %String [CodeMode = expression]{
 $tr(d,"ATGC","TACG")}

Also I believe Java lacks convenience of compile time ObjectScript macros:

#define DNAComplement(%dna) $tr(%dna,"ATGC","TACG")Write $$$DNAComplement("ATC")
0